Prerequisites

Objectives

  • Functions Overloading: make functions with same name, but different parameters types/count.
  • Make your own types by using struct feature of C++.
  • Make another version of your functions implemented in Part 1 but with using your own types (structs).
  • Realize importance of struct to encapsulate objects.
  • Realize the importance of struct to return multiple values instead of pass-by-reference.
  • Realize the readability gains by using struct.
  • Understand function overloading.

Deadline

Sunday 4/3/2018 11:59 PM.

Assignment: Part 2

Using the same repository of Part 1. It is required to make your own structs to encapsulate multiple variables. Attempt the new requirements on the same files of Part 1.

Example 1

  • E1.1 declare a struct (new type), with name Triangle, to encapsulate the triangle sides, three doubles.

Solution: add the following struct inside mathematics namespace.

struct Triangle
{
    double a;
    double b;
    double c;
};
  • E1.2 add another version of double heron( double a , double b , double c ), but with using Triangle type, as follows:
double heron( Triangle t )
{
    // Same logic here.
    // DRY solution is recommended
}
  • E1.3 Edit the main function in heron.cpp to make it work with Triangle instead of a, b, c.

Solution: in your main function in heron.cpp replace the commented lines in the following snippets

// double a = 0;
// double b = 0;
// double c = 0;

// Replace the commented lines above with this line.
mathematics::Triangle t{ 0 , 0 , 0 };

// std::cin >> a >> b >> c;

// replace the commented line above with this line.
std::cin >> t.a >> t.b >> t.c;

// std::cout << mathematics::heron( a , b , c ) << std::endl;

// replace the commented line above with this line.
std::cout << mathematics::heron( t ) << std::endl;

Requirement 1: in arrays.hpp file

  • R1.1 declare a struct (new type), with name DoubleArray, to encapsulate the base pointer and the size of double array.
  • R1.2 declare a struct (new type), with name CharacterArray, to encapsulate the base pointer and the size of character array.
  • R1.3 add another version of the functions you implemented in Part 1 using the following declarations:
void printAll( DoubleArray array )
{
    // Logic here
}

double maxArray( DoubleArray array )
{
    // Logic here
}

double minArray( DoubleArray array )
{
    // Logic here
}

double meanArray( DoubleArray array )
{
    // Logic here
}

double varianceArray( DoubleArray array )
{
    // Logic here
}

Requirement 2: in ecg.hpp file

  • R2.1 ECG array is actually a double array. Instead of making a new struct as follows:
struct ECGArray
{
    double *array;
    int size;
};

We can just make a new type alias of DoubleArray with using an interesting name, using the following syntax:

using ECGArray = arrays::DoubleArray;

To use the above feature in C++, the feature of using TypeAlias = SomeType, is supported in C++ standard of 2011. When you compile make sure to inform the compiler what standard you are using. So you will need to add an additional flag to the compiler -std=c++11.

This line declares a new type equivalent to DoubleArray but with another name (alias).

  • R2.2 declare a struct (new type), with name Statistics, to encapsulate the following double members:
    • mean
    • variance
    • min
    • max
  • R2.3 Make another version of analyzeECG that takes ECGArray as input and returns Statistics:
Statistics analyzeECG( ECGArray ecg )
{
    // Logic here (4 lines)
}
  • R2.4 Change main function in analyzeECG.cpp file to make it using the custom types you just made. Follow the comments below to change some lines of analyzeECG.cpp:
int main( int argc , char **argv )
{
    if( argc != 2 )
    {
        std::cout << "Invalid usage!" << std::endl;
        return 1;
    }
    else
    {
        int size = 0;
        double *ecgArray = helpers::getECG( argv[1] , size );

        // 1. declare `ecg::ECGArray` variable with name ecg, and initialize it with {ecgArray,size}
        

        // 2. declare `ecg::Statistics` variable with name stats, and initialize it with the results of `analyzeECG( ecg )`


        std::cout <<"ECG average : " << stats.mean << std::endl
                 << "ECG variance: " << stats.variance << std::endl
                 << "ECG range   : (" << stats.min << "," << stats.max << ")" << std::endl;

        delete [] ecgArray;
        return 0;
    }
}

Requirement 3 (Bonus)

Feel free to add your own structs in dna.hpp. The objective of using struct (or you custom type), is to make you code more readable, modular, and strongly-typed. Also, make use of your new types in the main function in analyzeDNA.cpp.

Submission

  • As usual, commit and push your changes.
  • Requirement 3 is completely counted as bonus.
  • Also, you may obtain bonus with correct logic by consistent adoption of KISS and DRY principles. Also, make your code clean, well-aligned, and use descriptive variable names.

Generating Executables and Testing Output

Compiling and Testing calculator.cpp

$ g++ -std=c++11 calculator.cpp -o Calculator
$ ./Calculator 24 / 7
3.42857
$ ./Calculator 24 \* 7

Note: asterisk * is a special character for the terminal. You need to explicitly use \* to specify multiplication operation.

Compiling and Testing heron.cpp

$ g++ -std=c++11 heron.cpp -o Heron
$ ./Heron 3 4 5
6

Compiling and Testing heron.cpp

$ g++ -std=c++11 heron.cpp -o Heron
$ ./Heron 3 4 5
6

Compiling and Testing analyzeECG.cpp

We compile and test using an ECG dataset stored in datasets/ecg_data.txt.

Our application in the main function loads data from the file then use ecg::analyzeECG function implemented in ecg.hpp.

$ g++ -std=c++11 analyzeECG.cpp -o AnalyzeECG
$ ./AnalyzeECG datasets/ecg_data.txt
ECG average : 0.785639
ECG variance: 0.00780314
ECG range   : (0,1.288)

Compiling and Testing analyzeDNA.cpp

We compile and test using a DNA dataset stored in datasets/genetic_data.txt.

Our application in the main function loads data from the file then use dna::analyzeDNA function implemented in dna.hpp.

$ g++ -std=c++11 analyzeDNA.cpp -o AnalyzeDNA
$ ./AnalyzeDNA datasets/genetic_data.txt
Adenine (A) content:75
Guanine (G) content:84
Cytocine(C) content:83
Thymine (T) content:76

Complementary Sequence:
CCAGTATTTGACAGGCTGGACTGAGCTACTTGCCGTTCCGGGATAAGTAGTTCAGACAGGCTGCCCACAACGTACAAAGACGGCCAGTTCTCCGCATATCGCGGCATTCGAGTCCGGCAAATAGCGAGTTAGCCTCTTCTTGCGCTGGACCTTTTCTAGCCGCATGACTAGTTGCCAAGGCTGAAGCCCAAGTTAGAGTGGCATGTAGTCCCTCAGTGAAGGGAATGGCTCGAGTCGAAGCAGCTTACAGCACAGCTCTCGACTCCTAATTGGGTCGAAGCCTATCAACTATCCACGTAGTGTCCAGTATTTGACAGT