Week 9 & 10: Introduction to Bioinformatics

class: center, middle
# Introduction to Bioinformatics

Eslam Adel

email: `eslam.a.mahmoud@eng1.cu.edu.eg`
---
    
## Overview

* Cell is the basic structural, functional and biological unit of all known living organisms.

---

* Cell nuclei contains cell's genetic materials DNA and RNA
* DNA forms the chromosomes.
* Human has 23 pairs of chromosomes. 
* Human Genome is distributed along these chromosomes.

---

---
<img src="../../images/w7/levels.png"  width="90%">

---

## DNA

* DNA stands for Deoxyribonucleic acids. 
* DNA has two strands of four types of nucleotides.
    * Adenine (A)
    * Guanine (G)
    * Cytosine (C)
    * Thymine (T)

* The two polymers are complementary to each other.
* DNA makes us different
---

---

---

## Genome Data

This is how gnome data looks like

---

## Genome replication

* Genome replication basically is to copy or make a clone of the gnome.
* Not for one time it is for million of times. 
* Gnome replication is a complex process 
* Till now it is not fully understood by the biologists.

---

## DNA Replication

---
## Replication Origin

* Finding replication origin is a key for many applications 
    * gene therapy
    * genetic modified food like frost-resistant tomatoes and [ pesticide-resistant corn](http://www.genewatch.org/sub-568238)

* The idea of gene therapy simply is to infect patient who lack a specific gene with artificial gene that encode a therapeutic protein. Once become inside the cell it will be replicated and treat the patient.  
---

---

## First human gene therapy experimentally

* A four-year old girl became the first gene therapy patient on September 14, 1990 at the NIH Clinical Center.
* She has adenosine deaminase (ADA) deficiency, a genetic disease which leaves her defenseless against infections.
* White blood cells were taken from her, and the normal genes for making adenosine deaminase were inserted into them.
* The corrected cells were reinjected into her.

<img src="../../images/w7/2-sm.gif"  width="70%">
---

* So where is engineering here. It is purely biological problem.  
* Only biologist can find experimentally the origin of replication. 
* Simply he could cut cell DNA to pieces and find which piece will make the cell stop replication and hence it must be the origin of replication.
<img src="../../images/w7/question.jpg  "  width="60%">

---

## Hidden message in Replication origin

* [The Gold-Bug](https://en.wikipedia.org/wiki/The_Gold-Bug) short story tells us about a hidden message of pirate treasures.
* This message must be encoded to be understood.

---

* It was noticed that **;48** sequence is frequently repeated in that message,
* given that it is encoded from english and the most frequent word in english is THE we can replace ; with T, 4 with H, and 8 with E.

---

* We have a better chance now to encode the message

* So frequent word is the hidden message for decoding.

---

### Counting words

* So the first problem we need to solve is to count number of repetitions of a pattern in the text.

PatternCount("GCGCG", "GCG")
> Output
2
```

**Lets try to implement it**

---

### Getting Started with Python

* Python is interpreted high level programming language for general purpose computing.

* You already installed anaconda. We can use spyder IDE to run our code, but we will use jupyter notebook.

---

### Variables

Python is untyped language

```python
x = 5
y = 'Hello SBME'
```
---

### Lists

```python
# Initialize the list
myList = [2, 55, 565]

# add an element at the end of the list
myList.append(8)

# Add element in specific index
myList.insert(1, 7)

print( myList ) # ??
print( myList[0] ) # ??
print( myList[3] ) # ??
print( myList[4] ) # ??
```

---

### Arithmetic Operations

```python

x = 19
y = 18

z = x / y
z = x * y
z = x + y
z = x - y

```
---

### Comparison Operators

operator | meaning
---|---
==	|Equal to
!=	|Not equal to
<	|Less than
>	|Greater than
<=	|Less than or equal to
>=	|Greater than or equal to

---
### Logical Operations

```python
x = True
y = False

x or y 
x and y 
not x 
```
---
### If, elif, else

```python

x = 25 
y = 20

if x < y:
    print("y is greater than x")
elif x == y:
    print("x and y are equal")
else:
    print("x is greater than y")
```
---

### Loops

```python

for i in range(10):
  print( i )

i = 0
while i < 10 :
  print( i )
  i += 1
```
---
### Functions

```python
def mean( list ):
  sum = 0
  for element in list:
    sum += element
  return sum / len( list )

m = mean([1,12,42,1,23,12])
print( m )
```
---

### Importing Libraries

```python 
import numpy as np
```
---

### Reverse complement

---

Given a text of DNA string get its reverse complement

```python
    def reverseComplement(Text):
        complementDict = {}
        complementDict["A"] = "T"
        complementDict["C"] = "G"
        complementDict["G"] = "C"
        complementDict["T"] = "A"
        reverseComplement = "" # an empty string
        for i in reversed(Text):
            reverseComplement = reverseComplement +  complementDict[i]
        return reverseComplement

reverseComplement("AAAACCCGGT")
> Output
ACCGGGTTTT        
```
---
### Frequent words

Given a text find frequent words with a specific length k.

```python
        FrequentWords(Text, k)
            FrequentPatterns ← an empty set
            for i ← 0 to |Text| − k
                Pattern ← the k-mer Text(i, k)
                Count(i) ← PatternCount(Text, Pattern)
            maxCount ← maximum value in array Count
            for i ← 0 to |Text| − k
                if Count(i) = maxCount
                    add Text(i, k) to FrequentPatterns
            remove duplicates from FrequentPatterns
        return FrequentPatterns
FrequentWords("ACGTTGCATGTCGCATGATGCATGAGAGCT", 4)
> Output
CATG GCAT
```
---

## Useful links

[Finding Hidden Messages in DNA (Bioinformatics I)  ](https://www.coursera.org/learn/dna-analysis)

Online course [link](http://www.hcbravo.org/cmsc423/calendar/)